zgc:103481

Ensembl ID:
ENSDARG00000055730
ZFIN ID:
ZDB-GENE-041114-35
Description:
hypothetical protein LOC492475 [Source:RefSeq peptide;Acc:NP_001007348]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22855 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078124 Essential Splice Site 132 381 2 6
ENSDART00000086141 Essential Splice Site 133 450 2 7
Genomic Location (Zv9):
Chromosome 16 (position 29098297)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26974071
GRCz11 16 26847513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAAATTATTATTTCTGTGAAACTGCACATTTACTTTGTTAAATTCA[A/G]GGAGGAGCTCAAAAAAGGACTGAAGTCCTTTCAAGAGATGCTTAAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link