
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000055683
- Ensembl ID:
- ENSDARG00000055683
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28456 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22649 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa28456
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078059 | Nonsense | 52 | 292 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 15 (position 24435147)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 25102220 GRCz10 15 25146334 GRCz11 15 25037485 GRCz11 15 25081599 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTATAAAATCCATCACTTGATTGGTCAGGGATCAACAGGAGTCATCTA[T/A]GATGGAATTCGTCTGTCGGATTGCCGAATGGTTTGTTTCAGACATAACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22649
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078059 | Essential Splice Site | 63 | 292 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 15 (position 24434920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 25146107 GRCz11 15 25081372 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGAAAGGATCACGATTGTAAGTACACACTCGCAACATTGTTAAAAATA[G/A]TCTCCAGTTCAGTTCAATCACATCTCACTAATACGTCTATTATCTCTCCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: