zgc:158782

Ensembl ID:
ENSDARG00000055679
ZFIN ID:
ZDB-GENE-070209-253
Description:
protein MTO1 homolog, mitochondrial [Source:RefSeq peptide;Acc:NP_001076478]
Human Orthologue:
MTO1
Human Description:
mitochondrial translation optimization 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:19261]
Mouse Orthologue:
Mto1
Mouse Description:
mitochondrial translation optimization 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14054 Nonsense Available for shipment Available now
sa13825 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078052 Nonsense 504 659 10 13
Genomic Location (Zv9):
Chromosome 12 (position 15406483)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14262136
GRCz11 12 14300439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTCTGAACAGCGCTATAATAAAGCTCTTCTGGTTCAGGCAAGTT[T/A]GAAGCAGGCTCTATCTACTCTGCAGTCYATCCATCTCTCCGCTGCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078052 Nonsense 615 659 12 13
Genomic Location (Zv9):
Chromosome 12 (position 15414669)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14270322
GRCz11 12 14308625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCATTGCCAAATGACATTGACTATCTGGCTCTACCCATCTCGCTTTCT[C/T]AGGAGGTCCGAGAGATTCTGGACAGAGTGCGACCAAGCACAGTAAGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link