akap12

Ensembl ID:
ENSDARG00000055678
ZFIN ID:
ZDB-GENE-030131-9753
Description:
A-kinase anchor protein 12 [Source:RefSeq peptide;Acc:NP_001091654]
Human Orthologue:
AKAP12
Human Description:
A kinase (PRKA) anchor protein 12 [Source:HGNC Symbol;Acc:370]
Mouse Orthologue:
Akap12
Mouse Description:
A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa72 Nonsense Available for shipment Available now
sa15047 Nonsense Available for shipment Available now
sa43451 Nonsense Mutation detected in F1 DNA During 2018
sa43450 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa72
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072   None 207 None 3
ENSDART00000110883 Nonsense 191 1533 2 3
Genomic Location (Zv9):
Chromosome 20 (position 26445860)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26517163
GRCz11 20 26416253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAACAGGGACAATATCAGAGAAAGAACCAGAGCCAGAAGTGCCAGCT[G/T]AATCGCCCACAAGCCCACCCTCTCAGGAGACACAGAGTCCCTTTAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072   None 207 None 3
ENSDART00000110883 Nonsense 552 1533 2 3
Genomic Location (Zv9):
Chromosome 20 (position 26444777)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26516080
GRCz11 20 26415170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGAGTCACAGGCAGAATCTAAGACAGAACCAAAAGCTGAGAAGTCT[G/T]AAYCTGTTGCAGAAGAGCCAAAGAGAAAAATGGATACATCTGTGTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072   None 207 None 3
ENSDART00000110883 Nonsense 827 1533 2 3
Genomic Location (Zv9):
Chromosome 20 (position 26443951)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26515254
GRCz11 20 26414344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTAGAAGAGACTGAAATGGTTTCTGCTGTTTCACGTGTTACAGCAT[C/A]ACCAGATACATCAGGCGAGACAACCCCTGTCCCTGGTGATGGTGTAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072   None 207 None 3
ENSDART00000110883 Nonsense 1391 1533 2 3
Genomic Location (Zv9):
Chromosome 20 (position 26442260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26513563
GRCz11 20 26412653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAAGTGAAGTTGAGTCTGATCTCAAGGAAGTGCAAGCAGAAATCCAG[C/T]AAGAGATAAAAGCTGTACCAGAAGAAAAGACGGCAGAAACATCTGTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link