zgc:110816

Ensembl ID:
ENSDARG00000055676
ZFIN ID:
ZDB-GENE-050327-51
Description:
UPF0364 protein C6orf211 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q58EM4]
Human Orthologue:
C6orf211
Human Description:
chromosome 6 open reading frame 211 [Source:HGNC Symbol;Acc:17872]
Mouse Orthologue:
1700052N19Rik
Mouse Description:
RIKEN cDNA 1700052N19 gene Gene [Source:MGI Symbol;Acc:MGI:1920669]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39280 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078062 Essential Splice Site 134 448 4 5

The following transcripts of ENSDARG00000055676 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26418955)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26490258
GRCz11 20 26389348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCACATTTTTAATGGTTTAATTAATTTGTTTTGTTTGTGTTTCCAAA[G/A]TCCACCGATGCATAACTTTGACCCGTTTAAGGAGGGAAAAACGCAAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link