zgc:152904

Ensembl ID:
ENSDARG00000055669
ZFIN ID:
ZDB-GENE-060929-856
Description:
neural cell adhesion molecule 2 [Source:RefSeq peptide;Acc:NP_001070212]
Human Orthologue:
NCAM2
Human Description:
neural cell adhesion molecule 2 [Source:HGNC Symbol;Acc:7657]
Mouse Orthologue:
Ncam2
Mouse Description:
neural cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:97282]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24804 Nonsense Available for shipment Available now
sa45866 Nonsense Mutation detected in F1 DNA During 2018
sa38233 Essential Splice Site Available for shipment Available now
sa44440 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078058 Nonsense 278 810 7 25
Genomic Location (Zv9):
Chromosome Zv9_NA999 (position 47834)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150432.1 47834
GRCz11 KN150432.1 47834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGCATTGTAGTCCAGCCTCACATCACT[C/T]AGCTGAGGAACGTGACCGCAGTGGAGGGCAGCGCAGCCATGATCTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078058 Nonsense 512 810 16 25
Genomic Location (Zv9):
Chromosome Zv9_NA999 (position 27969)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150432.1 27969
GRCz11 KN150432.1 27969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTAATATGCCATGAAGAGGAGCGCTTCACTTCACAGGAGACTTCAGCC[A/T]GCCCTGGAGAATACACACACACACACACACACACACACACTCACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078058 Essential Splice Site 512 810 17 25
Genomic Location (Zv9):
Chromosome Zv9_NA999 (position 26020)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150432.1 26020
GRCz11 KN150432.1 26020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACATCCACACTTCATCACTGGAGGAAACCCGCGTCTCTTTATTTCA[C/T]ACAGAATGAACGAAGCTGTCGCTCACACACACTTACAATCTGCAGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078058 Essential Splice Site 605 810 21 25
Genomic Location (Zv9):
Chromosome Zv9_NA999 (position 18541)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150432.1 18541
GRCz11 KN150432.1 18541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGACGGAGGGATGCCCATCGTCGAGTACATCCTCAAGTATAAAACC[G/T]TGAGTGCAGCACACATCACTCTGCTGTTCATATGAAGGCCAAGTGTGTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link