ACLY (2 of 2)
- Ensembl ID:
- ENSDARG00000055652
- Description:
- ATP citrate lyase [Source:HGNC Symbol;Acc:115]
- Human Orthologue:
- ACLY
- Human Description:
- ATP citrate lyase [Source:HGNC Symbol;Acc:115]
- Mouse Orthologue:
- Acly
- Mouse Description:
- ATP citrate lyase Gene [Source:MGI Symbol;Acc:MGI:103251]
Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa41986 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa18271 |
Essential Splice Site |
Available for shipment |
Available now |
sa14734 |
Essential Splice Site |
Available for shipment |
Available now |
sa41985 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa6242 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa35232 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41984 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa41986
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Nonsense |
68 |
1096 |
2 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15180278)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
14035931 |
GRCz11 |
12 |
14074234 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTTTTACTTGTGCAGAGGCTAGTTGTGAAGCCAGATCAACTGATTAAA[C/T]GAAGAGGAAAGCTGGGATTGGTAGCAGTTGACCTGAAACTTGAGAGTGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18271
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Essential Splice Site |
292 |
1096 |
8 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15150669)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
14006322 |
GRCz11 |
12 |
14044625 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGAACATAAACAGAACAGATAAYAAACGTGACCTCGTTATATYTGTTTTA[G/A]TGACACTATATGTGATCTGGGTGGAGTAGATGAGTTGGCCAACTATGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14734
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Essential Splice Site |
358 |
1096 |
9 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15145850)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
14001503 |
GRCz11 |
12 |
14039806 |
- KASP Assay ID:
- 2260-5132.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCATYGGTGGCAGTATTGCTAACTTCACAAATGTAGCAGCAACTTTTAAG[G/A]TTAGACTATACGGCTTGWTCTAGATATTGATAGAGTATTGAYATATTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41985
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Essential Splice Site |
398 |
1096 |
11 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15143799)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
13999452 |
GRCz11 |
12 |
14037755 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACACAAATAATCTTATCTAATCTTTTTGTTTCTTTGTTTCCTTTTTGTT[G/T]CAATAGGAAAGACTACTGGTATTCCCATTCATGTCTTTGGCACAGAAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6242
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Essential Splice Site |
529 |
1096 |
14 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15126959)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
13982612 |
GRCz11 |
12 |
14020915 |
- KASP Assay ID:
- 554-4118.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CCTGTAATTTTGAAAGCATGGTTTTATGATTTTTCATTTTTRTGTGTGCC[A/G]GTGGTGACCACAAGCAGAAATTTTACTGGGGTCAWAAGGAGATCTTACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35232
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Nonsense |
572 |
1096 |
14 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15126829)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
13982482 |
GRCz11 |
12 |
14020785 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGAAACATCCAGATGTTGACGTACTCATTAACTTTGCCTCCCTTCGCT[C/A]AGCCTTCGACAGTACCATGGAAACACTTCAGTACCCTCAGGTAATATCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41984
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000078037 |
Nonsense |
872 |
1096 |
21 |
27 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15098462)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
13954115 |
GRCz11 |
12 |
13992418 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGTGTTTAAAGAGGAAATGGGTGTCGGAGGAGTGCTGGGCCTGTTGTG[G/A]TTCCAGAGGAGGTTTGTCATTTAAAATTGGATCATTATGAAAATACAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: