si:ch211-9a18.2

Ensembl ID:
ENSDARG00000055649
ZFIN IDs:
ZDB-GENE-050417-281, ZDB-GENE-050417-281, ZDB-GENE-070424-195
Description:
hypothetical protein LOC550458 [Source:RefSeq peptide;Acc:NP_001017762]
Human Orthologue:
TUBB6
Human Description:
tubulin, beta 6 [Source:HGNC Symbol;Acc:20776]
Mouse Orthologue:
Tubb6
Mouse Description:
tubulin, beta 6 Gene [Source:MGI Symbol;Acc:MGI:1915201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45817 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078040   None 215 None 5
ENSDART00000122495   None 447 None 4
ENSDART00000135264 Essential Splice Site 58 153 2 4
Genomic Location (Zv9):
Chromosome 24 (position 3133492)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2945790
GRCz11 24 2944534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCGACAGAATTAATGTGTACTACAACGAGGCGTCCTGTAAGTATG[T/C]GCGTGTCAGTGAGTATGAAACGCTCCCCTTAACAGACTCACAGTGACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link