zgc:153345

Ensembl ID:
ENSDARG00000055622
ZFIN IDs:
ZDB-GENE-061103-487, ZDB-GENE-061103-487
Description:
hypothetical protein LOC566129 [Source:RefSeq peptide;Acc:NP_001071081]
Human Orthologues:
ARHGAP11A, ARHGAP11B
Human Descriptions:
Rho GTPase activating protein 11A [Source:HGNC Symbol;Acc:15783]
Rho GTPase activating protein 11B [Source:HGNC Symbol;Acc:15782]
Mouse Orthologue:
Arhgap11a
Mouse Description:
Rho GTPase activating protein 11A Gene [Source:MGI Symbol;Acc:MGI:2444300]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21766 Essential Splice Site Available for shipment Available now
sa41691 Nonsense Mutation detected in F1 DNA During 2018
sa21767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078012 Essential Splice Site 74 922 2 14
ENSDART00000115379 Essential Splice Site 74 270 2 6
Genomic Location (Zv9):
Chromosome 10 (position 34422480)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33450445
GRCz11 10 33394305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGCTCCCTCAGCATGACCTGCCTGACAATGGCGGTACAGTACCTCGG[T/C]ATGTTTAATAACATCACTTGTTTATTAGATAACGAAATCTGAAGCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078012 Nonsense 111 922 4 14
ENSDART00000115379 Nonsense 111 270 4 6
Genomic Location (Zv9):
Chromosome 10 (position 34425429)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33453394
GRCz11 10 33397254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTAACACGAATACCAAATGCTTTTCGTTCATAGGCAGATCTGGAG[C/T]AGGGAAAGCCAGTTTTCCTTCCGCCACATTCATCCCTCCTGCAGGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078012 Nonsense 298 922 6 14
ENSDART00000115379   None 270 None 6
Genomic Location (Zv9):
Chromosome 10 (position 34427259)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33455224
GRCz11 10 33399084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGTTTAGTAAGAGGACTGGACTCAGTGTTTACAGAAGTCTGAGAAGA[C/T]AACGAAGGCGAAGTGTTGGTGGTGAGACTTTGATGTGATTGTAATGAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link