zgc:136367

Ensembl ID:
ENSDARG00000055620
ZFIN IDs:
ZDB-GENE-060616-196, ZDB-GENE-060616-196
Description:
acyl-CoA dehydrogenase family member 9, mitochondrial [Source:RefSeq peptide;Acc:NP_001038772]
Human Orthologue:
ACAD9
Human Description:
acyl-CoA dehydrogenase family, member 9 [Source:HGNC Symbol;Acc:21497]
Mouse Orthologue:
Acad9
Mouse Description:
acyl-Coenzyme A dehydrogenase family, member 9 Gene [Source:MGI Symbol;Acc:MGI:1914272]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8627 Nonsense Mutation detected in F1 DNA During 2018
sa8753 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41850 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078008 Nonsense 32 469 1 14
ENSDART00000083010 Nonsense 32 630 1 18
Genomic Location (Zv9):
Chromosome 11 (position 27634983)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26463809
GRCz11 11 26701425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGGAATTTATTCGCTGTTCGTGTCGCGCAAACAGGAGAATRTCTTTA[T/A]CAGTTTCAGTCGCAGCGCTTCATTAGGTCCAGCTCGAGGAGTTTAGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078008   463 469 13 14
ENSDART00000083010 Essential Splice Site 463 630 13 18
Genomic Location (Zv9):
Chromosome 11 (position 27627773)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26456599
GRCz11 11 26694215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTTACAGGGATGCAGTATGCTGGCAAAATATTAACTGGAAAAATAAA[G/A]TATGTCTGGAATRTTCACRTGAAMAAGTGGATTTCATCCTTGTCCTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078008   None 469 None 14
ENSDART00000083010 Nonsense 581 630 17 18
Genomic Location (Zv9):
Chromosome 11 (position 27620302)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26449128
GRCz11 11 26686744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAACGGCCTTGTTAAAACTTTCAGGTGCTGCTCACCAACACTTTCTG[C/A]AAGGATGCTCATTTCAAGAACAACTACATGTTGAGTCAGCTTCAAAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link