si:dkey-238m4.2
- Ensembl ID:
- ENSDARG00000055607
- ZFIN ID:
- ZDB-GENE-100921-78
- Human Orthologue:
- CGN
- Human Description:
- cingulin [Source:HGNC Symbol;Acc:17429]
- Mouse Orthologue:
- Cgn
- Mouse Description:
- cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]
Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa11671 |
Essential Splice Site |
Available for shipment |
Available now |
sa15682 |
Essential Splice Site |
Available for shipment |
Available now |
sa36111 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa12730 |
Nonsense |
Available for shipment |
Available now |
sa28647 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa32088 |
Nonsense |
Available for shipment |
Available now |
sa18067 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa11671
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 16 (position 24724469)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22628785 |
GRCz11 |
16 |
22544175 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGGAACAGCTGGGGAGGAAGAACACAGAACTGCACCAAACACATTCAGA[G/T]TAAGAAGAAATACAYTTGTTTGCCATTATAAACATTCAGACATCTACAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15682
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 16 (position 24724355)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22628671 |
GRCz11 |
16 |
22544061 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGCATTAATTATAGTTWACCMATGTTGTTKTTGTGTGCTTTTTTTCCTCA[G/A]TCTTACTCAGTTACGTATGGACAGAGAGAACGCAGAGTCTCATGTTAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36111
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000077998 |
Essential Splice Site |
447 |
1182 |
None |
20 |
ENSDART00000131657 |
Essential Splice Site |
40 |
763 |
None |
15 |
- Genomic Location (Zv9):
- Chromosome 16 (position 24724220)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22628536 |
GRCz11 |
16 |
22543926 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGAGGAGAGAAACTGAAAACAAAGCTCAAGCTGACACAATGCACATGG[T/A]AATCACACACATAAGCACACACACACACACCCCAGAGAAAGGCTAAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12730
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 24721252)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22625568 |
GRCz11 |
16 |
22540958 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGGARTTGATGGCATTGAGAGCTGAATTGGATGAAGCTGCAGTGCTGAGA[C/T]AAAAGCAGGAGGACATTCAGAGGCAAAGAGAGAGGGAGCTGACGGCCCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28647
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000077998 |
Essential Splice Site |
977 |
1182 |
15 |
20 |
ENSDART00000131657 |
Essential Splice Site |
558 |
763 |
10 |
15 |
- Genomic Location (Zv9):
- Chromosome 16 (position 24713495)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22617811 |
GRCz11 |
16 |
22533201 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAACAGTGCAGAGATGCTGACAGAAAGAATCACCAGGAGCCGAGATCAG[G/A]TACATTATATTTAGTACACTCAACATTTTTGGGACCCAAAACTGAATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32088
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 24711434)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22615750 |
GRCz11 |
16 |
22531140 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCACATTGATGCAATGTTAATGTTTTGATATAATCTTCTGTAGATTGAA[C/T]AGCTGCGTGCAGAACTCATGCAAGAGAGATCCTCCAAACAAGACCTGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18067
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 24711138)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
22615454 |
GRCz11 |
16 |
22530844 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTTCTTTCAGATAAAGGAGTATAAGACTCGTGTAGCTGAGATGGAAGGC[C/T]AGTCACRTTCCTCCACTGGTGTCTCACAGCTGGAGAGCAAAATCCAGGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: