stat5.2

Ensembl ID:
ENSDARG00000055588
ZFIN ID:
ZDB-GENE-040818-1
Description:
signal transducer and activator of transcription 5.2 [Source:RefSeq peptide;Acc:NP_001003984]
Human Orthologues:
STAT5A, STAT5B
Human Descriptions:
signal transducer and activator of transcription 5A [Source:HGNC Symbol;Acc:11366]
signal transducer and activator of transcription 5B [Source:HGNC Symbol;Acc:11367]
Mouse Orthologues:
Stat5a, Stat5b
Mouse Descriptions:
signal transducer and activator of transcription 5A Gene [Source:MGI Symbol;Acc:MGI:103036]
signal transducer and activator of transcription 5B Gene [Source:MGI Symbol;Acc:MGI:103035]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31864 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124364 Nonsense 699 786 17 19
ENSDART00000124638 Nonsense 700 787 17 19

The following transcripts of ENSDARG00000055588 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14697669)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13553322
GRCz11 12 13591625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTATAATGTAAATTTTCTTTTTACAGCTAAAGCAGTGGGGGATGGATA[T/A]GTCAAACCAGAGATCAAGCAGGTGGTAAAGGTTGAGTGAGTATCTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link