
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gpr61
- Ensembl ID:
- ENSDARG00000055570
- ZFIN ID:
- ZDB-GENE-081104-239
- Description:
- Novel protein similar to H.sapiens GPR61, G protein-coupled receptor 61 (GPR61) [Source:UniProtKB/Tr
- Human Orthologue:
- GPR61
- Human Description:
- G protein-coupled receptor 61 [Source:HGNC Symbol;Acc:13300]
- Mouse Orthologue:
- Gpr61
- Mouse Description:
- G protein-coupled receptor 61 Gene [Source:MGI Symbol;Acc:MGI:2441719]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12995 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12995
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077950 | Nonsense | 323 | 421 | 1 | 1 |
ENSDART00000142006 | Nonsense | 363 | 452 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26030441)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25158359 GRCz11 8 25177498 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGCAGATCAGGGAGGAGCTGGCCAGAAACTTGGCCTTCGTGTTCAAGTG[G/A]GGKCRTCCCGGTGAGGAGGATCAGCTGCCCAGTCGARAGGCKTCTATCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: