wnt1

Ensembl ID:
ENSDARG00000055554
ZFIN ID:
ZDB-GENE-980526-526
Description:
Protein Wnt-1 [Source:UniProtKB/Swiss-Prot;Acc:P24257]
Human Orthologue:
WNT1
Human Description:
wingless-type MMTV integration site family, member 1 [Source:HGNC Symbol;Acc:12774]
Mouse Orthologue:
Wnt1
Mouse Description:
wingless-related MMTV integration site 1 Gene [Source:MGI Symbol;Acc:MGI:98953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24353 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077931 Nonsense 94 370 2 4
ENSDART00000130491 Nonsense 99 375 3 5
ENSDART00000136240 Nonsense 94 371 2 4
Genomic Location (Zv9):
Chromosome 23 (position 27895562)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27728384
GRCz11 23 27654925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATGCTATTGCAGCAGGTCTGCACACAGCCATCAAAGAATGCAAATG[G/A]CAGTTTCGTAACCGTCGTTGGAACTGTCCCACTACCCACAGCCCCAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link