si:dkey-270m17.5

Ensembl ID:
ENSDARG00000055539
ZFIN ID:
ZDB-GENE-091204-250
Description:
LOC557419 protein [Source:UniProtKB/TrEMBL;Acc:A7E2I1]
Human Orthologue:
EPDR1
Human Description:
ependymin related protein 1 (zebrafish) [Source:HGNC Symbol;Acc:17572]
Mouse Orthologue:
Epdr1
Mouse Description:
ependymin related protein 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2145369]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23959 Nonsense Available for shipment Available now
sa37335 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077910 Nonsense 103 213 4 6

The following transcripts of ENSDARG00000055539 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27913253)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28482164
GRCz11 21 28518859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACTACAGAAACCAGACTTGCATTAAGCAAGCATTGAAGGAGCCGTTC[A/T]GACATCTTGGTGTTCCCCATAATGCCCATTTCCTGAGTCAGATGGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077910 Essential Splice Site 173 213 6 6

The following transcripts of ENSDARG00000055539 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27907679)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28476590
GRCz11 21 28513285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGACAGTGATGAGAAACGCTTCTGAAATTGCAGATTTTTTTTTCACA[G/A]CTTCTTCGACCTGGTGGAGGGAATCGAGAACCCCGACGTCTTCATCCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link