zgc:153609

Ensembl ID:
ENSDARG00000055538
ZFIN ID:
ZDB-GENE-060825-261
Description:
late secretory pathway protein AVL9 homolog [Source:RefSeq peptide;Acc:NP_001039030]
Human Orthologue:
AVL9
Human Description:
AVL9 homolog (S. cerevisiase) [Source:HGNC Symbol;Acc:28994]
Mouse Orthologue:
Avl9
Mouse Description:
AVL9 homolog (S. cerevisiase) Gene [Source:MGI Symbol;Acc:MGI:1926187]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41989 Nonsense Mutation detected in F1 DNA During 2018
sa18159 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077903 Nonsense 24 426 1 11
ENSDART00000099334 Nonsense 24 587 1 16
Genomic Location (Zv9):
Chromosome 12 (position 15316940)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14172593
GRCz11 12 14210896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCCGTGCTGCACATTGTAGTGGTAGGATTTCACCACAAAAAAGGGTG[T/A]CAGGTAAGAGCCCTCATATTTGTGTATAATAATCTGTTTTAAATGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077903 Nonsense 156 426 6 11
ENSDART00000099334 Nonsense 157 587 7 16
Genomic Location (Zv9):
Chromosome 12 (position 15297627)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14153280
GRCz11 12 14191583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATTGTATTGTTCTTTGTATTCTGTAGGAGCTTTATGATCATATGAAC[A/T]GATCTTTAAACTGTACATCGCTGGAGGGATCACAGATTTATCTAAGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link