Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153609
- Ensembl ID:
- ENSDARG00000055538
- ZFIN ID:
- ZDB-GENE-060825-261
- Description:
- late secretory pathway protein AVL9 homolog [Source:RefSeq peptide;Acc:NP_001039030]
- Human Orthologue:
- AVL9
- Human Description:
- AVL9 homolog (S. cerevisiase) [Source:HGNC Symbol;Acc:28994]
- Mouse Orthologue:
- Avl9
- Mouse Description:
- AVL9 homolog (S. cerevisiase) Gene [Source:MGI Symbol;Acc:MGI:1926187]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa41989 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa18159 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa41989
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077903 | Nonsense | 24 | 426 | 1 | 11 |
| ENSDART00000099334 | Nonsense | 24 | 587 | 1 | 16 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15316940)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 14172593 GRCz11 12 14210896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAACCCGTGCTGCACATTGTAGTGGTAGGATTTCACCACAAAAAAGGGTG[T/A]CAGGTAAGAGCCCTCATATTTGTGTATAATAATCTGTTTTAAATGCTCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18159
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077903 | Nonsense | 156 | 426 | 6 | 11 |
| ENSDART00000099334 | Nonsense | 157 | 587 | 7 | 16 |
- Genomic Location (Zv9):
- Chromosome 12 (position 15297627)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 14153280 GRCz11 12 14191583 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTATTGTATTGTTCTTTGTATTCTGTAGGAGCTTTATGATCATATGAAC[A/T]GATCTTTAAACTGTACATCGCTGGAGGGATCACAGATTTATCTAAGTAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
