sertad2

Ensembl ID:
ENSDARG00000055530
ZFIN ID:
ZDB-GENE-030616-569
Description:
SERTA domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_997959]
Human Orthologue:
SERTAD2
Human Description:
SERTA domain containing 2 [Source:HGNC Symbol;Acc:30784]
Mouse Orthologue:
Sertad2
Mouse Description:
SERTA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1931026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45486 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077899 Nonsense 200 361 2 2
Genomic Location (Zv9):
Chromosome 13 (position 24743669)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24389329
GRCz11 13 24519779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGATAGCTTCTCTTCAGCCCTGGATGAGATTGAGGAGCTCTGTCCTT[C/A]ACCTTTACCTACAGCTACGTCAGCGCCCGGTGCTACCTCCCCCTCGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link