ypel3

Ensembl ID:
ENSDARG00000055510
ZFIN ID:
ZDB-GENE-030516-4
Description:
Proteim yippee-like 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWI4]
Human Orthologue:
YPEL3
Human Description:
yippee-like 3 (Drosophila) [Source:HGNC Symbol;Acc:18327]
Mouse Orthologue:
Ypel3
Mouse Description:
yippee-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913340]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40067 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113843 Splice Site, Nonsense 90 119 4 5
ENSDART00000136001 Splice Site, Nonsense 90 119 4 5

The following transcripts of ENSDARG00000055510 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26847802)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26056434
GRCz11 3 26187305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTGATATTTATTGTGAGAATTGCCACACCACACTGGGCTGGAAATA[C/A]GTGAGTATGATTTGTTTTAACAGAACCGATGCCAAAAGGCTTTATTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link