
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch1073-184j22.1
- Ensembl ID:
- ENSDARG00000055498
- ZFIN ID:
- ZDB-GENE-081104-74
- Description:
- Novel protein similar to family with sequence similarity 132 [Source:UniProtKB/TrEMBL;Acc:B8JLI7]
- Human Orthologue:
- FAM132B
- Human Description:
- family with sequence similarity 132, member B [Source:HGNC Symbol;Acc:26727]
- Mouse Orthologue:
- Fam132b
- Mouse Description:
- family with sequence similarity 132, member B Gene [Source:MGI Symbol;Acc:MGI:3606476]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39756 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39756
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077861 | Nonsense | 197 | 294 | 5 | 8 |
ENSDART00000139762 | Nonsense | 111 | 208 | 3 | 6 |
ENSDART00000146906 | Nonsense | 57 | 103 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 2 (position 5024247)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 5469975 GRCz11 2 5381857 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTTAACATCAGCAGCGGCCGCTATACGGCTCCAGTGTCTGGCTTCTAT[C/T]AGCTCTCAGCTAATCTGCTGCTAGGTATGGGTTTTTCTGGACGGCAGATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: