zgc:195063

Ensembl ID:
ENSDARG00000055463
ZFIN ID:
ZDB-GENE-080723-63
Description:
leucine-rich repeat, immunoglobulin-like domain and transmembrane domain-containing protein 3 [Sour
Human Orthologue:
LRIT3
Human Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 [Source:HGNC Symbol;Acc:24783]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42427 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42426 Nonsense Mutation detected in F1 DNA During 2018
sa22524 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077823 Essential Splice Site 39 636 1 4
Genomic Location (Zv9):
Chromosome 14 (position 37565127)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36004454
GRCz11 14 36344768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGTGCACATGTGTCTACCACGGCCGCAGCGACGGCACTGGCAGCAGG[T/C]ACAGTAAACGCACTACTACACAACAGCATTTAATAAAATTTTAATAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077823 Nonsense 602 636 4 4
Genomic Location (Zv9):
Chromosome 14 (position 37549223)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35988550
GRCz11 14 36328864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATGAAGCAGAGGACTCTAAACGGGCAGGCCAATGATCTGTGGGCA[C/T]GAAGACAGACTCAAGAGTCGGAGAGGATGTTACTGTGTTCGCGTTCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077823 Nonsense 625 636 4 4
Genomic Location (Zv9):
Chromosome 14 (position 37549152)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35988479
GRCz11 14 36328793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGATGTTACTGTGTTCGCGTTCGAGCATCGACTCGCAGATGACATA[C/A]AAAAGTGACAGCTCTAGATCTGAGTATCTGTGCTAATGTATTGACCATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link