zgc:165580

Ensembl ID:
ENSDARG00000055445
ZFIN ID:
ZDB-GENE-070928-5
Description:
hypothetical protein LOC555262 [Source:RefSeq peptide;Acc:NP_001103169]
Human Orthologue:
SLC22A15
Human Description:
solute carrier family 22, member 15 [Source:HGNC Symbol;Acc:20301]
Mouse Orthologue:
Slc22a15
Mouse Description:
solute carrier family 22 (organic anion/cation transporter), member 15 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9673 Essential Splice Site Available for shipment Available now
sa36377 Splice Site, Nonsense Available for shipment Available now
sa8710 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077804 Essential Splice Site 176 497 5 12
Genomic Location (Zv9):
Chromosome 17 (position 19333922)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19483933
GRCz11 17 19503769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTACTTTCACAGTAATSGCATGATAMTAAYGYGTTTCTCTGTGYTCC[A/T]GGGACCTTGACTAATATGACCTTTGCAGTGGGCATCTCTCTGTTCGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077804 Splice Site, Nonsense 338 497 8 12
Genomic Location (Zv9):
Chromosome 17 (position 19336817)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19486828
GRCz11 17 19506664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCACACTCTTCTGCTGTATTCATTTGAGTGTGTTTGTTTTTCTTTCAG[G/A]GCAGGCAGGAGAAAGTCAATGGCCAATTTTCTTGCCTTTGCAGGCATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077804 Nonsense 409 497 10 12
Genomic Location (Zv9):
Chromosome 17 (position 19338894)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19488905
GRCz11 17 19508741
KASP Assay ID:
2261-0870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTNNNNNNTGTGTGTGTGTGTTCGTGTTAGGAATGCAGGTTTGGGAGTGTG[T/A]TCAATGTCTTGTAGRGTTGGGGGAATTCTGGCACCATTTGTACCAAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link