zcchc7l

Ensembl ID:
ENSDARG00000055443
ZFIN ID:
ZDB-GENE-030102-2
Description:
Zcchc7l protein [Source:UniProtKB/TrEMBL;Acc:Q4QRH2]
Human Orthologue:
ZCCHC7
Human Description:
zinc finger, CCHC domain containing 7 [Source:HGNC Symbol;Acc:26209]
Mouse Orthologue:
Zcchc7
Mouse Description:
zinc finger, CCHC domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2442912]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39602 Nonsense Mutation detected in F1 DNA During 2018
sa8940 Nonsense Mutation detected in F1 DNA During 2018
sa14502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077799   None 347 None 7
ENSDART00000102837 Nonsense 34 293 2 4
ENSDART00000129066 Nonsense 34 627 2 9
ENSDART00000142751 Nonsense 34 627 2 9
Genomic Location (Zv9):
Chromosome 1 (position 20544944)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21017040
GRCz11 1 21709977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCATTTAGGGCTCTCCTTGAGATGTTCTCAGGGTTTCAGGAACGGTA[C/A]GACCATGAGGACGAGCTGTACAGGGATGAAGAAGACTCATCAGGTTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077799   None 347 None 7
ENSDART00000102837 Nonsense 87 293 2 4
ENSDART00000129066 Nonsense 87 627 2 9
ENSDART00000142751 Nonsense 87 627 2 9
Genomic Location (Zv9):
Chromosome 1 (position 20544787)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21016883
GRCz11 1 21709820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCCAGGAAAACCATGAGGAATCAAGCAAAGTCCAACCATTGGTCCCA[C/T]AAACTCAACTTCAGCYGGAAACCATGCCTCCTGCTCCACCTGTAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077799 Nonsense 209 347 6 7
ENSDART00000102837   None 293 None 4
ENSDART00000129066 Nonsense 491 627 9 9
ENSDART00000142751 Nonsense 491 627 9 9
Genomic Location (Zv9):
Chromosome 1 (position 20395024)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20919435
GRCz11 1 21612372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCASCACACACCGAAGAAACGYATCGCACACACACCCAAACACAATCCA[C/T]AAACAAACCAACAAAACACACACTGGAGGGTCAAGCAGAACTCCAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link