adamtsl7

Ensembl ID:
ENSDARG00000055439
ZFIN ID:
ZDB-GENE-070816-2
Human Orthologues:
ADAMTSL4, THSD4
Human Descriptions:
ADAMTS-like 4 [Source:HGNC Symbol;Acc:19706]
thrombospondin, type I, domain containing 4 [Source:HGNC Symbol;Acc:25835]
Mouse Orthologues:
Adamtsl4, Thsd4
Mouse Descriptions:
ADAMTS-like 4 Gene [Source:MGI Symbol;Acc:MGI:2389008]
thrombospondin, type I, domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2672033]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32656 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077833 Nonsense 456 533 9 10
ENSDART00000148327 Nonsense 597 674 11 12
Genomic Location (Zv9):
Chromosome 1 (position 20361913)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20886324
GRCz11 1 21579261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCCCGCTCTTGTGAAGGAGGCTTTCGAGTGAGGGAGGTACGGTGTT[T/A]ACGAGATGACCTGACATCAAGTCATGACTGTGATCCTGCCCTTGAACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link