
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-177p2.14
- Ensembl ID:
- ENSDARG00000055426
- ZFIN ID:
- ZDB-GENE-041001-119
- Description:
- RWD domain-containing protein 2B [Source:RefSeq peptide;Acc:NP_001068583]
- Human Orthologue:
- RWDD2B
- Human Description:
- RWD domain containing 2B [Source:HGNC Symbol;Acc:1302]
- Mouse Orthologue:
- Rwdd2b
- Mouse Description:
- RWD domain containing 2B Gene [Source:MGI Symbol;Acc:MGI:1858215]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39281 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39281
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077782 | Nonsense | 166 | 289 | 4 | 5 |
ENSDART00000138249 | Nonsense | 162 | 285 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 26942920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 27014223 GRCz11 20 26913313 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCCAAAAACAACATTCAGTAGACTCTGGATCTACAGCCATCATATCTA[C/A]AATAAGATCAAGAGGAAGAACATTCTGGAATGGGCAAAGGAGCTAAACCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: