
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zp2l1
- Ensembl ID:
- ENSDARG00000055415
- ZFIN ID:
- ZDB-GENE-060818-3
- Description:
- zona pellucida glycoprotein 2, like 1 [Source:RefSeq peptide;Acc:NP_001098574]
- Human Orthologues:
- ZP1, ZP4
- Human Descriptions:
- zona pellucida glycoprotein 1 (sperm receptor) [Source:HGNC Symbol;Acc:13187]
- zona pellucida glycoprotein 4 [Source:HGNC Symbol;Acc:15770]
- Mouse Orthologue:
- Zp1
- Mouse Description:
- zona pellucida glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:103073]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34695 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34695
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077745 | Nonsense | 170 | 404 | 3 | 8 |
The following transcripts of ENSDARG00000055415 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 36685497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 35823386 GRCz11 9 35632571 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGTGGAAGATGACTTCCTAATCTATGAAAACAGAATGACATCTGTATA[T/G]GAAGTAAATGTTGGACCTCTAGGCTCTATCACAAGAGATAGCCATTATGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Non-alcoholic fatty liver disease histology (other): Genome-wide association study identifies variants associated with histologic features of nonalcoholic Fatty liver disease. (View Study)
- Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: