si:dkey-67c22.2

Ensembl ID:
ENSDARG00000055389
ZFIN ID:
ZDB-GENE-030131-5845
Description:
hypothetical protein LOC792544 [Source:RefSeq peptide;Acc:NP_001123872]
Human Orthologue:
SRRM5
Human Description:
serine/arginine repetitive matrix 5 [Source:HGNC Symbol;Acc:37248]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34696 Nonsense Mutation detected in F1 DNA During 2018
sa9800 Nonsense Available for shipment Available now
sa34697 Nonsense Mutation detected in F1 DNA During 2018
sa2494 Nonsense Available for shipment Available now
sa13667 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 238 1069 4 7
ENSDART00000122057 Nonsense 238 1069 5 7
ENSDART00000122169 Nonsense 226 229 5 5
ENSDART00000130549 Nonsense 238 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889090)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36026979
GRCz11 9 35836164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACATAAAAGTGGAACCTATTGATAAAGATGAAAGTTATGGTATAGCT[C/T]AAGCACTTCCCGATATTATTCCCAAACAAGAAAATGTGCAGAAGGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 481 1069 4 7
ENSDART00000122057 Nonsense 481 1069 5 7
ENSDART00000122169   None 229 None 5
ENSDART00000130549 Nonsense 481 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36027708
GRCz11 9 35836893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCATAGAAGATCAATTTCAAGAAGCCCAAGACGTCGAAGTAAATCT[C/T]GATCCCCCTAWCGCTCCAGGCCCTCTAAGTCACGTTCTCCTGCAGTCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 597 1069 4 7
ENSDART00000122057 Nonsense 597 1069 5 7
ENSDART00000122169   None 229 None 5
ENSDART00000130549 Nonsense 597 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890167)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028056
GRCz11 9 35837241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATCTCCTGCTAAAGAAGACAAGTCTTTAAAGGATAAGAATTCAAAA[G/T]AAACCTCAGAAACCACACAGAAACTTTTGGTAGCCATAGAGGAAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 673 1069 4 7
ENSDART00000122057 Nonsense 673 1069 5 7
ENSDART00000122169   None 229 None 5
ENSDART00000130549 Nonsense 673 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890396)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028285
GRCz11 9 35837470
KASP Assay ID:
554-2809.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGAGGATCCMTCTAAATGTGAAGAAAGACCTATCCGGTCCAGATCTT[T/A]GTCCTTAGATCCAGTTCCTCAACACGGTACAGMAGGGTCAGAAGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 858 1069 4 7
ENSDART00000122057 Nonsense 858 1069 5 7
ENSDART00000122169   None 229 None 5
ENSDART00000130549 Nonsense 858 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890950)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028839
GRCz11 9 35838024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTCACGCCGGAGAAGACCAGCATTTAGAGGGCGATCATTTGACAGA[C/T]GAGATCGGTGGAAACGTGAACCAAGTCATTCCCCAATTTTAATTCTCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link