
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnb5b
- Ensembl ID:
- ENSDARG00000055377
- ZFIN ID:
- ZDB-GENE-040426-1712
- Description:
- guanine nucleotide-binding protein subunit beta-5 [Source:RefSeq peptide;Acc:NP_957040]
- Human Orthologue:
- GNB5
- Human Description:
- guanine nucleotide binding protein (G protein), beta 5 [Source:HGNC Symbol;Acc:4401]
- Mouse Orthologue:
- Gnb5
- Mouse Description:
- guanine nucleotide binding protein (G protein), beta 5 Gene [Source:MGI Symbol;Acc:MGI:101848]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10693 | Nonsense | Available for shipment | Available now |
sa36703 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10693
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077724 | Nonsense | 107 | 395 | 4 | 13 |
ENSDART00000142390 | Nonsense | 99 | 212 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 37514252)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 39095955 GRCz11 18 39076963 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGGTCAGTTTGTCATGAAGACCCGTCGAACGTTAAAAGGGCATGGAAAT[A/T]AAGTKCTGTGTATGGACTGGTGCCGGGACAAGAGAAGAATCGTCAGCTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36703
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077724 | Nonsense | 352 | 395 | 12 | 13 |
ENSDART00000142390 | None | 212 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 37540104)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 39121807 GRCz11 18 39102815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAGGCCGATTGCTGTTCGCTGGATATAATGATTACAACATTAACGTCT[G/A]GGATGTCCTGAAAGGTACCAGAGTGGCAATTCTCTTTGGTCATGAAAATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: