zgc:92151

Ensembl ID:
ENSDARG00000055350
ZFIN IDs:
ZDB-GENE-050522-551, ZDB-GENE-050522-551
Description:
SUN domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001018145]
Human Orthologue:
SUN1
Human Description:
Sad1 and UNC84 domain containing 1 [Source:HGNC Symbol;Acc:18587]
Mouse Orthologue:
Sun1
Mouse Description:
Sad1 and UNC84 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924303]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19957 Essential Splice Site Available for shipment Available now
sa19958 Essential Splice Site Available for shipment Available now
sa19956 Nonsense Available for shipment Available now
sa17526 Essential Splice Site Available for shipment Available now
sa33109 Nonsense Mutation detected in F1 DNA During 2018
sa2093 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa19957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876 Essential Splice Site 159 849 5 21
ENSDART00000124824 Essential Splice Site 159 987 5 25
ENSDART00000130261 Essential Splice Site 159 987 5 25
ENSDART00000109876 Essential Splice Site 159 849 5 21
ENSDART00000124824 Essential Splice Site 159 987 5 25
ENSDART00000130261 Essential Splice Site 159 987 5 25
Genomic Location (Zv9):
Chromosome 3 (position 13480243)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13078474
GRCz11 3 13228586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGACCAGTCCACACTCAGACAGTCCTCCACCACAGAGACATACTCTGG[T/C]CAGTGGCTTTCACAGGTTCTGTTATTGTAGGACAGACACTGCAATTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876 Essential Splice Site 159 849 5 21
ENSDART00000124824 Essential Splice Site 159 987 5 25
ENSDART00000130261 Essential Splice Site 159 987 5 25
ENSDART00000109876 Essential Splice Site 159 849 5 21
ENSDART00000124824 Essential Splice Site 159 987 5 25
ENSDART00000130261 Essential Splice Site 159 987 5 25
Genomic Location (Zv9):
Chromosome 3 (position 13480243)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13078474
GRCz11 3 13228586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGACCAGTCCACACTCAGACAGTCCTCCACCACAGAGACATACTCTGG[T/C]CAGTGGCTTTCACAGGTTCTGTTATTGTAGGACAGACACTGCAATTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876   None 849 None 21
ENSDART00000124824 Nonsense 276 987 8 25
ENSDART00000130261 Nonsense 276 987 8 25
Genomic Location (Zv9):
Chromosome 3 (position 13475395)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13083322
GRCz11 3 13233434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGATGAGCATCAATGTTGGCTTACAGGTGACGACTGCAAAGGGAAG[C/T]AGCACATGGAGATGAACACAGAGCGTAAACACTATTCCTACATCCACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876 Essential Splice Site 387 849 10 21
ENSDART00000124824 Essential Splice Site 525 987 14 25
ENSDART00000130261 Essential Splice Site 525 987 14 25
Genomic Location (Zv9):
Chromosome 3 (position 13465716)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13092796
GRCz11 3 13242908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAYCCCTGCTTAAAGAGCAAGATGTCCCTCCACTGGTCGWCGCACAG[G/T]TAATAAACCAGGCGTAAAACAACATCTGGCTKTAGATGTGTGCAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876 Nonsense 414 849 11 21
ENSDART00000124824 Nonsense 552 987 15 25
ENSDART00000130261 Nonsense 552 987 15 25
Genomic Location (Zv9):
Chromosome 3 (position 13462659)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13095853
GRCz11 3 13245965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGGCTCTGCTGGAGCAGCGTGTGTCTGCGTTGTGGGAAAGCGTCCGG[C/T]AGGGTGAACTGAAGGCCAAGCAGCAGCACGAGGAGGCGCTGGGTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2093
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109876 Nonsense 429 849 11 21
ENSDART00000124824 Nonsense 567 987 15 25
ENSDART00000130261 Nonsense 567 987 15 25
Genomic Location (Zv9):
Chromosome 3 (position 13462613)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13095899
GRCz11 3 13246011
KASP Assay ID:
554-2636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCAGGGTGAACTGAAGGCCAAGCAGCAGCACGAGGAGGCGCTGGGTT[T/A]AACTCAATCTCTCCAGRAGCAGATCAAGACACAGACAGACAGGGAGARCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link