
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mark1
- Ensembl ID:
- ENSDARG00000055343
- ZFIN ID:
- ZDB-GENE-070626-2
- Description:
- serine/threonine-protein kinase MARK1 [Source:RefSeq peptide;Acc:NP_001107948]
- Human Orthologue:
- MARK1
- Human Description:
- MAP/microtubule affinity-regulating kinase 1 [Source:HGNC Symbol;Acc:6896]
- Mouse Orthologue:
- Mark1
- Mouse Description:
- MAP/microtubule affinity-regulating kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2664902]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25186 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32415 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa25186
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000013234 | Nonsense | 14 | 325 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 41764745)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 38371603 GRCz11 22 38358344 - KASP Assay ID:
- 554-7809.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTCTCTTCTCCCACAGCTCTTTCGTGAAGTGAGGATTATGAAGGTCT[T/G]AAATCATCCTAATATAGGTAAGGAATCATCCTGATATCCATTTTACATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32415
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000013234 | Nonsense | 73 | 325 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 41773016)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 38379874 GRCz11 22 38350073 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTGCATGTGTGTGTGTGTCCACAGATTGTGTCTGCAGTGCAGTATTG[C/A]CATCAGAAGAGAATAGTCCACAGGGATCTCAAGGTGAGACGATTATAACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Genome-wide association study in bipolar patients stratified by co-morbidity. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: