sypl2a

Ensembl ID:
ENSDARG00000055307
ZFIN ID:
ZDB-GENE-040426-1434
Description:
synaptophysin-like 2a [Source:RefSeq peptide;Acc:NP_956961]
Human Orthologue:
SYPL2
Human Description:
synaptophysin-like 2 [Source:HGNC Symbol;Acc:27638]
Mouse Orthologue:
Sypl2
Mouse Description:
synaptophysin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1328311]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41888 Nonsense Mutation detected in F1 DNA During 2018
sa41889 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077649 Nonsense 67 235 3 7
ENSDART00000145427 Nonsense 67 235 3 6
Genomic Location (Zv9):
Chromosome 11 (position 37206248)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36103476
GRCz11 11 36365459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAATGTCCAGACAAAGATGATGTTGATGTTACTGCTAATTTTGGATA[T/A]CCATTCAGGTATAAACAACCACATTTCAATCCTATTTCTATACATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077649 Nonsense 210 235 6 7
ENSDART00000145427 Nonsense 210 235 6 6
Genomic Location (Zv9):
Chromosome 11 (position 37213029)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36110257
GRCz11 11 36372240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAGCTTTTTGGATTCCTGAACCTGATTCTGTGGGCAGGGAACTGCTG[G/A]TTCATCTACAAGGAGACTCCGTTTCACAAGCCGGCAAACCCACCAGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link