Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ret1
- Ensembl ID:
- ENSDARG00000055305
- ZFIN ID:
- ZDB-GENE-980526-307
- Description:
- proto-oncogene tyrosine-protein kinase receptor Ret [Source:RefSeq peptide;Acc:NP_858048]
- Human Orthologue:
- RET
- Human Description:
- ret proto-oncogene [Source:HGNC Symbol;Acc:9967]
- Mouse Orthologue:
- Ret
- Mouse Description:
- ret proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:97902]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa42210 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| hu2846 | Nonsense | Available for shipment | Available now |
| sa35492 | Essential Splice Site | Available for shipment | Available now |
| sa15240 | Nonsense | Available for shipment | Available now |
| sa22307 | Nonsense | Available for shipment | Available now |
| sa2684 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42210
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Nonsense | 59 | 1106 | 2 | 20 |
| ENSDART00000139237 | Nonsense | 41 | 1046 | 1 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25827659)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25473319 GRCz11 13 25603769 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGTTGCTTCAGGTCATTTCAATGCGGGAATTCCCTACAGAGAGGCCTTA[T/G]TTCTTCCTGTGCTCGCACAGAGACGCTTTTACATCATGGTTTCACATAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- hu2846
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Nonsense | 229 | 1106 | 4 | 20 |
| ENSDART00000139237 | Nonsense | 211 | 1046 | 3 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25824425)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25470085 GRCz11 13 25600535 - KASP Assay ID:
- 554-0012.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACAAGTGGACCGCGAGGAGAAGGAAGTGTATCATCTGGATATAGTCTG[T/A]ATGGTACGAACAGAAAGAAATCTGGAGGAGGTCTTCAGATCTTTACATGT
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037ventral mandibular arch
ZFA:0001273quality
PATO:0000001abnormal
PATO:0000460
- mRNA Expression Profiling Preview:
- View complete mRNA expression profile
| Region | 3' end position | 3' end strand | Adjusted p-value | Log2 fold change (mutant/sibling) | Closest Ensembl gene 3' end | Gene name | e74 Ensembl Gene ID |
|---|---|---|---|---|---|---|---|
| 25:32079501-32079818 | 32079818 | 1 | 1.96 × 10-07 | -1.7 | -2 | tnni2a.1 | ENSDARG00000045592 |
| 8:5862381-5863000 | 5862381 | -1 | 4.48 × 10-06 | -1.2 | -2 | diabloa | ENSDARG00000035323 |
| 6:40676532-40677100 | 40676532 | -1 | 1.43 × 10-05 | -1.6 | 100 | myhb | ENSDARG00000001993 |
| 16:56119901-56120100 | 56122673 | 1 | 6.74 × 10-05 | -1.0 | -1 | fabp10a | ENSDARG00000038439 |
| 5:46432652-46433000 | 46432652 | -1 | 2.64 × 10-04 | 1.7 | -6 | fbp2 | ENSDARG00000012366 |
Mutation Details
- Allele Name:
- sa35492
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Essential Splice Site | 619 | 1106 | 10 | 20 |
| ENSDART00000139237 | Essential Splice Site | 601 | 1046 | 9 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25817707)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25463367 GRCz11 13 25593817 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTACTGCTTTGAAGGAAAGTGCTTCTGTGAAAGAGATGAACCGGAGGG[T/C]GAGCTGCAGCTGATTGTTTTTTTCTCTGTAAAGATTGTATTTTTTATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15240
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Nonsense | 760 | 1106 | 13 | 20 |
| ENSDART00000139237 | Nonsense | 742 | 1046 | 12 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25814990)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25460650 GRCz11 13 25591100 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAATKACTYTAACCATTMATTTTTTCACCACAGAAAATGCRTCTCACAGC[G/T]AGCTTCGAGAYCTCCTSTCAGAGTTCACATTGCTYAAGCAGGTTAATCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22307
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Nonsense | 800 | 1106 | 14 | 20 |
| ENSDART00000139237 | Nonsense | 782 | 1046 | 13 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25814781)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25460441 GRCz11 13 25590891 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTTATGTTAATGTGTTCAGGTCCATTATACTTAATTGTTGAATACGCC[A/T]AGTATGGTTCACTACGTAACTTCCTGAGAGAGAGCCGCAAAGTTGGGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2684
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077627 | Nonsense | 849 | 1106 | 14 | 20 |
| ENSDART00000139237 | Nonsense | 831 | 1046 | 13 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25814634)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 25460294 GRCz11 13 25590744 - KASP Assay ID:
- 554-2592.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCCAGACGAGAGAGCTCTGACCATGGGCGACCTGATCTCGTTCGCCTGG[C/T]AGATCTCTAGAGGAATGCAATACCTAGCTGAGATGAAGGTATGCCAGTGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hirschsprung's disease: Genome-wide association study identifies NRG1 as a susceptibility locus for Hirschsprung's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
