atxn7l2a

Ensembl ID:
ENSDARG00000055300
ZFIN ID:
ZDB-GENE-060519-13
Description:
ataxin 7-like 2 [Source:RefSeq peptide;Acc:NP_001038750]
Human Orthologue:
ATXN7L2
Human Description:
ataxin 7-like 2 [Source:HGNC Symbol;Acc:28713]
Mouse Orthologue:
Atxn7l2
Mouse Description:
ataxin 7-like 2 Gene [Source:MGI Symbol;Acc:MGI:1919772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45436 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35137 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090520 Essential Splice Site 249 624 5 11
ENSDART00000127742 Essential Splice Site 260 723 5 10
ENSDART00000135360 Essential Splice Site 259 722 5 10

The following transcripts of ENSDARG00000055300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 37230746)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36127974
GRCz11 11 36389957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATGCATTAAATCCTGAATTTGATCATAAAATTTGTTGTGCTCCACA[G/A]AAAAAGAATGTGACCTTGACAAACACTGTGGTGTTTTGGACACTGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090520 Essential Splice Site None 624 None 11
ENSDART00000127742 Essential Splice Site 718 723 None 10
ENSDART00000135360 Essential Splice Site 717 722 None 10

The following transcripts of ENSDARG00000055300 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 37239646)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36136874
GRCz11 11 36398857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTCGGGACTCTCTGTAGGAGGAGAGAAGAAACTCAGCACACAAAAGG[T/C]GAGGGAGTGTTTAGGGCTGGATCTGACTTGTTCTCTGTTCTCATCACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link