slc12a10.3

Ensembl ID:
ENSDARG00000055253
ZFIN ID:
ZDB-GENE-060503-518
Description:
slc12a10.3 solute carrier family 12 (sodium/potassium/chloride transporters), member 10.3 [Source:R
Human Orthologue:
SLC12A3
Human Description:
solute carrier family 12 (sodium/chloride transporters), member 3 [Source:HGNC Symbol;Acc:10912]
Mouse Orthologue:
Slc12a3
Mouse Description:
solute carrier family 12, member 3 Gene [Source:MGI Symbol;Acc:MGI:108114]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17412 Nonsense Available for shipment Available now
sa11857 Essential Splice Site Available for shipment Available now
sa40826 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16613 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042955 Nonsense 147 965 5 27
ENSDART00000134653 Nonsense 178 934 5 24
Genomic Location (Zv9):
Chromosome 7 (position 4559311)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4249624
GRCz11 7 4387650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAGGATNAAAAATAAGTCAAAGCCAMTCTTTCCTCCAGGTGGTACGTA[C/A]TTCTTGATTTCTCGAAGTCTGGGTCCAGAGCTCGGAGCGCCCATTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042955   None 965 None 27
ENSDART00000134653 Essential Splice Site 222 934 6 24
Genomic Location (Zv9):
Chromosome 7 (position 4563605)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4253918
GRCz11 7 4391944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKATTATATTCCTGAAATTTTAAAGTAATCTACCGTTTTCTCTCTTCTCA[G/A]GAAAACAACGCTCAGATGGTGGACGATGTGAATGACGTKCGGATTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042955 Essential Splice Site 304 965 9 27
ENSDART00000134653 Essential Splice Site 340 934 9 24
Genomic Location (Zv9):
Chromosome 7 (position 4566051)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4256364
GRCz11 7 4394390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTGAATGTGTCTTTAACATGGCAGAGTGTGCATTTCTGTGTTTTGCA[G/T]GATCCCTCAGGTGGGATTCCTAAAGGGACCCTGTTGGCCATTTTCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042955 Essential Splice Site 581 965 15 27
ENSDART00000134653 Essential Splice Site 617 934 15 24
Genomic Location (Zv9):
Chromosome 7 (position 4572461)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4262774
GRCz11 7 4400800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCTCAATGTCCCTGACTGGTGTTGAAGACCATGTKAAAAACTTCAG[G/A]TATTGTAAACATAATAACTGAACTGACCTCTACAGATCATYAATACTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HDL cholesterol: Polymorphism in the CETP gene region, HDL cholesterol, and risk of future myocardial infarction: Genomewide analysis among 18 245 initially healthy women from the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link