zgc:123218

Ensembl ID:
ENSDARG00000055252
ZFIN ID:
ZDB-GENE-051030-75
Description:
hypothetical protein LOC641321 [Source:RefSeq peptide;Acc:NP_001032194]
Human Orthologue:
SNAP23
Human Description:
synaptosomal-associated protein, 23kDa [Source:HGNC Symbol;Acc:11131]
Mouse Orthologue:
Snap23
Mouse Description:
synaptosomal-associated protein 23 Gene [Source:MGI Symbol;Acc:MGI:109356]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32162 Nonsense Available for shipment Available now
sa11962 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077581 Nonsense 37 200 4 8

The following transcripts of ENSDARG00000055252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 33642008)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33483739
GRCz11 17 33436250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTTAAGTTTAGAAATTTGGTCATTTGCAGTGTTTGAACATGGGAGCC[G/T]AAACTATGACTATGTTGGATGAACAGGGAGGTGGGTCTTTATTTCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077581 Nonsense 174 200 7 8

The following transcripts of ENSDARG00000055252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 33644477)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33486208
GRCz11 17 33438719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAAGGGACCAAACACTGGAAATAAACAACAAGCTCGACGAACAGAAC[A/T]AAACCATTCAGGACATCCAGAATGACGTAAMGTGTTTYACTATCTGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link