
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-132b12.8
- Ensembl ID:
- ENSDARG00000055250
- ZFIN ID:
- ZDB-GENE-030131-5453
- Description:
- hypothetical protein LOC561391 [Source:RefSeq peptide;Acc:NP_001038424]
- Human Orthologues:
- CCNA1, CCNA2
- Human Descriptions:
- cyclin A1 [Source:HGNC Symbol;Acc:1577]
- cyclin A2 [Source:HGNC Symbol;Acc:1578]
- Mouse Orthologues:
- Ccna1, Ccna2
- Mouse Descriptions:
- cyclin A1 Gene [Source:MGI Symbol;Acc:MGI:108042]
- cyclin A2 Gene [Source:MGI Symbol;Acc:MGI:108069]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23363 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23363
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077577 | Essential Splice Site | 280 | 398 | 7 | 9 |
The following transcripts of ENSDARG00000055250 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 18 (position 38999648)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40712365 GRCz11 18 40702557 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTTCATTTTCTTCTCATCTCTGCCTCCATCGCACGCTGCAGTGACAAG[G/A]TCAGTTTACTTTAATTTGACCACCATTACCACTATTAAATGTCCCAAATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: