slc7a7

Ensembl ID:
ENSDARG00000055226
ZFIN ID:
ZDB-GENE-051127-5
Description:
Y+L amino acid transporter 1 [Source:RefSeq peptide;Acc:NP_001032648]
Human Orthologue:
SLC7A7
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a7
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44653 Nonsense Mutation detected in F1 DNA During 2018
sa15030 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077545 Nonsense 4 501 2 10
Genomic Location (Zv9):
Chromosome 7 (position 20723240)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19313676
GRCz11 7 19565644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTTTTTTGGTACCATCCCATATATTTAAAAAACAATGGCGTCCTA[C/A]AGCCCTACGCCTGCAGAAGAGGCATCCCCTGAGGTGTCGAACGGAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077545 Nonsense 241 501 4 10
Genomic Location (Zv9):
Chromosome 7 (position 20735491)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19325927
GRCz11 7 19577895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGATGTTGCACTGGCTTTATATTCTGCTCTTTTCTCCTACTCTGGATG[G/A]GACACTCTCAACTTYGTCACTGAGGAGATCAAAAACCCAGAGAGGTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link