
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dtnbp1b
- Ensembl ID:
- ENSDARG00000055206
- ZFIN ID:
- ZDB-GENE-060503-889
- Description:
- dystrobrevin binding protein 1b [Source:RefSeq peptide;Acc:NP_001038279]
- Human Orthologue:
- DTNBP1
- Human Description:
- dystrobrevin binding protein 1 [Source:HGNC Symbol;Acc:17328]
- Mouse Orthologue:
- Dtnbp1
- Mouse Description:
- dystrobrevin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2137586]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17933 | Essential Splice Site | Available for shipment | Available now |
sa11373 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17933
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104008 | Essential Splice Site | 68 | 216 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 19 (position 26658711)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 26588823 GRCz11 19 26173046 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RTGGAGCACTACCTGTCCACTGGATACCTACAGMTTGCAGAGAGGAGAGG[T/C]AAGATATGCCTTCAGTTYAAGTCTGAATCAKATATACCAAATGTTTAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11373
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104008 | Essential Splice Site | 116 | 216 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 19 (position 26650550)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 26580662 GRCz11 19 26164885 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTCAATTCTGGAGGCGAAGACAACAGYGTGGCCTCRCCAATGCTTGG[T/C]ATACATTCATATAGTGACATTTACCAATCATCAAGCAATGCATTTACCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: