zgc:136930

Ensembl ID:
ENSDARG00000055192
ZFIN ID:
ZDB-GENE-060312-16
Description:
hypothetical protein LOC563946 [Source:RefSeq peptide;Acc:NP_001034908]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15439 Essential Splice Site Available for shipment Available now
sa45106 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077514 Essential Splice Site 200 465 1 9
ENSDART00000082250 Essential Splice Site 211 476 1 9

The following transcripts of ENSDARG00000055192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32498683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32797590
GRCz11 2 32780808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATTGAGCTGGACAAYGTCAGGGGAACTGCWCAYGAGCTGAAGGCTAA[G/A]TGAGTGGTTTCTTTTTATTATTAAATCTGATTGTTTTCNNTTTTTTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077514 Essential Splice Site 313 465 5 9
ENSDART00000082250 Essential Splice Site 324 476 5 9

The following transcripts of ENSDARG00000055192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32501096)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32800003
GRCz11 2 32783221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTGCATTCCAAACTAACAGATCCTATACTGTCTACTTATGACTGCA[G/A]ATGGATGAGATGCAGACGGTCACGGCCAAAAACACAGAGGCTGTGTCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link