zhx2

Ensembl ID:
ENSDARG00000055162
ZFIN ID:
ZDB-GENE-031107-2
Description:
zinc fingers and homeoboxes protein 2 [Source:RefSeq peptide;Acc:NP_942109]
Human Orthologue:
ZHX2
Human Description:
zinc fingers and homeoboxes 2 [Source:HGNC Symbol;Acc:18513]
Mouse Orthologue:
Zhx2
Mouse Description:
zinc fingers and homeoboxes 2 Gene [Source:MGI Symbol;Acc:MGI:2683087]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42726 Nonsense Mutation detected in F1 DNA During 2018
sa22846 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077484 Nonsense 332 805 3 4
ENSDART00000137547 Nonsense 332 805 1 1
Genomic Location (Zv9):
Chromosome 16 (position 27879753)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25725440
GRCz11 16 25640472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTAAAACAAGGTATCAGTTGGTCTCCTGAGGAGGTTGAGGAAGCTCGA[A/T]AAAAGATGTTCAATGGAACGATTCAGCCTGTTCAACAGGCATTCACTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077484 Nonsense 658 805 3 4
ENSDART00000137547 Nonsense 658 805 1 1
Genomic Location (Zv9):
Chromosome 16 (position 27880731)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25726418
GRCz11 16 25641450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCACAAACCCAGTGGCCATCACCAGAAGAGTACAACCAACTAGAAGTT[C/T]AAACAGGGTTAGCACGTACAGAAATTGTCCGCTGGTTTAAGGACAACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link