zgc:113028

Ensembl ID:
ENSDARG00000055129
ZFIN ID:
ZDB-GENE-050809-111
Description:
hypothetical protein LOC565041 [Source:RefSeq peptide;Acc:NP_001030150]
Human Orthologue:
PIM3
Human Description:
pim-3 oncogene [Source:HGNC Symbol;Acc:19310]
Mouse Orthologue:
Pim3
Mouse Description:
proviral integration site 3 Gene [Source:MGI Symbol;Acc:MGI:1355297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25231 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38107 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077445 Essential Splice Site 67 320 3 6
ENSDART00000108692 Essential Splice Site 67 141 3 7
Genomic Location (Zv9):
Chromosome 25 (position 30652880)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29220241
GRCz11 25 29663248
KASP Assay ID:
554-7807.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGCCACGATCACATATTCATATGCGCGTTTTTCTCTTTTTGTCTGTA[G/C]GTTGCAATAAAACACGTCGCCAAGGAGAGAGTGACCGAATGGGGTACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077445 Essential Splice Site 84 320 None 6
ENSDART00000108692 Essential Splice Site 84 141 None 7
Genomic Location (Zv9):
Chromosome 25 (position 30653013)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29220374
GRCz11 25 29663381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGTATAAACGATTTATTTCTAACCAGTGCGGTTTTATTTGTATTCC[A/T]GAACGGGTCGCTGATTCCACTCGAGATTGTTTTGTTGAAGAAAGTGGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link