zgc:56068

Ensembl ID:
ENSDARG00000055108
ZFIN ID:
ZDB-GENE-040426-881
Description:
glycerophosphodiester phosphodiesterase 1 [Source:RefSeq peptide;Acc:NP_956537]
Human Orthologue:
GDE1
Human Description:
glycerophosphodiester phosphodiesterase 1 [Source:HGNC Symbol;Acc:29644]
Mouse Orthologue:
Gde1
Mouse Description:
glycerophosphodiester phosphodiesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1891827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43866 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005829 Essential Splice Site 214 333 4 6
Genomic Location (Zv9):
Chromosome 22 (position 27471330)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26986775
GRCz11 22 26849227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAACACAAGCATCGTCTGCTCATTTGAGCCCAAAGTCATCTATAGG[G/T]TAACACATTTATGTAATTAATTTCTTGTCATGCTGTGTTCAGATTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link