si:dkey-44g23.7

Ensembl ID:
ENSDARG00000055101
ZFIN ID:
ZDB-GENE-040914-13
Description:
heme oxygenase 2 [Source:RefSeq peptide;Acc:NP_001096609]
Human Orthologue:
HMOX2
Human Description:
heme oxygenase (decycling) 2 [Source:HGNC Symbol;Acc:5014]
Mouse Orthologue:
Hmox2
Mouse Description:
heme oxygenase (decycling) 2 Gene [Source:MGI Symbol;Acc:MGI:109373]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8475 Nonsense Mutation detected in F1 DNA During 2018
sa13370 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077783 Nonsense 116 310 4 6
ENSDART00000138311 Nonsense 116 242 4 5
Genomic Location (Zv9):
Chromosome 22 (position 27483019)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26998464
GRCz11 22 26860916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCRAGAGGCCTTGGCCAAAGACCTGGCGTAWTTCTATGGTGAAGACT[G/A]GGAGAGCCAGATYTCCTGCTCTGCTGCCACACAGCCCTATGTAGACCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077783 Essential Splice Site 227 310 4 6
ENSDART00000138311 Essential Splice Site 227 242 4 5
Genomic Location (Zv9):
Chromosome 22 (position 27482683)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26998128
GRCz11 22 26860580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAAGCTGCTAGATGAAGCCAACCTGGCTTTTAAATTGAACTTGGACG[T/C]AAGAGGATATAATTTCCATTYACTGGTTGWGATAATCAGATGATTATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link