zgc:85932

Ensembl ID:
ENSDARG00000055094
ZFIN ID:
ZDB-GENE-040426-2460
Description:
hypothetical protein LOC405875 [Source:RefSeq peptide;Acc:NP_998104]
Human Orthologues:
CAPN1, CAPN2, CAPN3, CAPN9
Human Descriptions:
calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
calpain 2, (m/II) large subunit [Source:HGNC Symbol;Acc:1479]
calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
calpain 9 [Source:HGNC Symbol;Acc:1486]
Mouse Orthologues:
Capn1, Capn2, Capn3, Capn8, Capn9
Mouse Descriptions:
calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]
calpain 2 Gene [Source:MGI Symbol;Acc:MGI:88264]
calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]
calpain 8 Gene [Source:MGI Symbol;Acc:MGI:2181366]
calpain 9 Gene [Source:MGI Symbol;Acc:MGI:1920897]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077396 Nonsense 381 581 10 17
ENSDART00000131180 Nonsense 381 671 10 20
Genomic Location (Zv9):
Chromosome 15 (position 42209772)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43481740
GRCz11 15 43362379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCCTGYTRGAGGAGGAYGACGACCCYAGTGACCCTGAACTAACGTG[T/A]TCATTCCTGCTGGCGCTCATGCAGAAACACACTCGGCAGAGAGGAACGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link