
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:85932
- Ensembl ID:
- ENSDARG00000055094
- ZFIN ID:
- ZDB-GENE-040426-2460
- Description:
- hypothetical protein LOC405875 [Source:RefSeq peptide;Acc:NP_998104]
- Human Orthologues:
- CAPN1, CAPN2, CAPN3, CAPN9
- Human Descriptions:
- calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
- calpain 2, (m/II) large subunit [Source:HGNC Symbol;Acc:1479]
- calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
- calpain 9 [Source:HGNC Symbol;Acc:1486]
- Mouse Orthologues:
- Capn1, Capn2, Capn3, Capn8, Capn9
- Mouse Descriptions:
- calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]
- calpain 2 Gene [Source:MGI Symbol;Acc:MGI:88264]
- calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]
- calpain 8 Gene [Source:MGI Symbol;Acc:MGI:2181366]
- calpain 9 Gene [Source:MGI Symbol;Acc:MGI:1920897]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11591 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11591
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077396 | Nonsense | 381 | 581 | 10 | 17 |
ENSDART00000131180 | Nonsense | 381 | 671 | 10 | 20 |
- Genomic Location (Zv9):
- Chromosome 15 (position 42209772)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 43481740 GRCz11 15 43362379 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGACCCTGYTRGAGGAGGAYGACGACCCYAGTGACCCTGAACTAACGTG[T/A]TCATTCCTGCTGGCGCTCATGCAGAAACACACTCGGCAGAGAGGAACGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: