
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbm4.2
- Ensembl ID:
- ENSDARG00000055080
- ZFIN ID:
- ZDB-GENE-030131-3019
- Description:
- RNA binding motif protein 4 like [Source:RefSeq peptide;Acc:NP_955971]
- Human Orthologues:
- RBM4, RBM4B, RP11-658F2.1
- Human Descriptions:
- RNA binding motif protein 4 [Source:HGNC Symbol;Acc:9901]
- RNA binding motif protein 4B [Source:HGNC Symbol;Acc:28842]
- RNA-binding protein 4 isoform 1 [Source:RefSeq peptide;Acc:NP_002887]
- Mouse Orthologue:
- Rbm4b
- Mouse Description:
- RNA binding motif protein 4B Gene [Source:MGI Symbol;Acc:MGI:1913954]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38604 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20916 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38604
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077395 | Nonsense | 260 | 384 | 3 | 5 |
ENSDART00000112169 | Nonsense | 260 | 384 | 3 | 4 |
ENSDART00000146368 | Nonsense | 260 | 384 | 2 | 3 |
The following transcripts of ENSDARG00000055080 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 23966574)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 22528326 GRCz11 7 22799483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCTAACCAGGGTGCCGACCGGCTATCCTGAGCGGCCTCCTGTGTATGAA[C/T]GAGATCGCTTCGGGAGCATTGACTATTACGAGAAGTTTCGGGCTCATCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20916
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077395 | Nonsense | 282 | 384 | 3 | 5 |
ENSDART00000112169 | Nonsense | 282 | 384 | 3 | 4 |
ENSDART00000146368 | Nonsense | 282 | 384 | 2 | 3 |
The following transcripts of ENSDARG00000055080 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 23966642)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 22528394 GRCz11 7 22799551 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGACTATTACGAGAAGTTTCGGGCTCATCCAGCTGCCTCTAGCTACTA[T/A]GAGGATAGGCCTCACGCCATCCCCCCTCCTCCACCTCCTCCCCCCCTCTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: