
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nxf1
- Ensembl ID:
- ENSDARG00000055076
- ZFIN ID:
- ZDB-GENE-030131-2585
- Description:
- Nxf1 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZT0]
- Human Orthologues:
- NXF1, NXF2, NXF2B, NXF3, NXF5
- Human Descriptions:
- nuclear RNA export factor 1 [Source:HGNC Symbol;Acc:8071]
- nuclear RNA export factor 2 [Source:HGNC Symbol;Acc:8072]
- nuclear RNA export factor 2B [Source:HGNC Symbol;Acc:23984]
- nuclear RNA export factor 3 [Source:HGNC Symbol;Acc:8073]
- nuclear RNA export factor 5 [Source:HGNC Symbol;Acc:8075]
- Mouse Orthologues:
- Nxf1, Nxf2, Nxf3, Nxf7
- Mouse Descriptions:
- nuclear RNA export factor 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1858330]
- nuclear RNA export factor 2 Gene [Source:MGI Symbol;Acc:MGI:1933192]
- nuclear RNA export factor 3 Gene [Source:MGI Symbol;Acc:MGI:2685230]
- nuclear RNA export factor 7 Gene [Source:MGI Symbol;Acc:MGI:2159343]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23951 | Nonsense | Available for shipment | Available now |
sa43658 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23951
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077381 | Nonsense | 299 | 642 | 9 | 21 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26066350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 26636168 GRCz11 21 26672863 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTTACCCCATTCATAGCTGGTTTGTCTAAACCTAAGTAACAACCGGT[T/A]ATTCAGGCTGGATGACCTGGTGGATATTATCCACAAAGTTCCCAACCTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43658
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077381 | Essential Splice Site | 324 | 642 | 9 | 21 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26066272)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 26636090 GRCz11 21 26672785 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCCACAAAGTTCCCAACCTAAAAATTCTCAATCTGTCACACAATGAGG[T/A]ATGAATGTGCTCTCTGATGCCTGTAGATTTATCTTGCTACCTGTAATTCT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: