zgc:162723

Ensembl ID:
ENSDARG00000055066
ZFIN ID:
ZDB-GENE-070424-38
Description:
Zgc:162723 protein [Source:UniProtKB/TrEMBL;Acc:A4FVK6]
Human Orthologue:
ZDHHC20
Human Description:
zinc finger, DHHC-type containing 20 [Source:HGNC Symbol;Acc:20749]
Mouse Orthologue:
Zdhhc20
Mouse Description:
zinc finger, DHHC domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1923215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16826 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077373 Splice Site, Nonsense 40 357 2 13
Genomic Location (Zv9):
Chromosome 10 (position 36584160)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35616862
GRCz11 10 35560722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTTGAWGGGATTGCTGATTGCCCTTTGCTTCTTTTCTCCCTGCAGA[C/A]ACAATCCCGARCGTGAACGAGCAAGGTAAGARGAACGCCAGTGAAAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link