zgc:103474

Ensembl ID:
ENSDARG00000055052
ZFIN ID:
ZDB-GENE-041010-118
Description:
Novel protein containing tubulin-binding domains (Zgc:103474) [Source:UniProtKB/TrEMBL;Acc:B0UXK7]
Human Orthologue:
MAP2
Human Description:
microtubule-associated protein 2 [Source:HGNC Symbol;Acc:6839]
Mouse Orthologue:
Mtap2
Mouse Description:
microtubule-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:97175]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14807 Nonsense Available for shipment Available now
sa8917 Nonsense Mutation detected in F1 DNA During 2018
sa21548 Nonsense Available for shipment Available now
sa21549 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059736   None 248 None 5
ENSDART00000077358   None 291 None 5
ENSDART00000112298 Nonsense 305 1710 6 16
ENSDART00000134294   None 374 None 8
ENSDART00000135581   None 169 None 3
ENSDART00000135902   None 248 None 6
ENSDART00000140436   None 591 None 9
ENSDART00000144893   None 154 None 4
ENSDART00000148306   None 179 None 6
Genomic Location (Zv9):
Chromosome 9 (position 40012124)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39150020
GRCz11 9 38959815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTAATAATTCAATACAATGCAGACTACTTGAGATTTGCTTTCAGCTT[T/A]GAAGATGGAAGCAGAGAGGCCAGAGAGTGAGAGGACAGATCCAATTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059736   None 248 None 5
ENSDART00000077358   None 291 None 5
ENSDART00000112298 Nonsense 522 1710 6 16
ENSDART00000134294   None 374 None 8
ENSDART00000135581   None 169 None 3
ENSDART00000135902   None 248 None 6
ENSDART00000140436   None 591 None 9
ENSDART00000144893   None 154 None 4
ENSDART00000148306   None 179 None 6
Genomic Location (Zv9):
Chromosome 9 (position 40012774)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39150670
GRCz11 9 38960465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAAGAGATGACTGCAGATTGTCTCCTGGGAAATTGGCTCTGGAGCAG[C/T]GAAGTTACTCTTTGAATATTACTATTGGGGCAATGGATCATGGAGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059736   None 248 None 5
ENSDART00000077358   None 291 None 5
ENSDART00000112298 Nonsense 823 1710 6 16
ENSDART00000134294   None 374 None 8
ENSDART00000135581   None 169 None 3
ENSDART00000135902   None 248 None 6
ENSDART00000140436   None 591 None 9
ENSDART00000144893   None 154 None 4
ENSDART00000148306   None 179 None 6
Genomic Location (Zv9):
Chromosome 9 (position 40013677)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39151573
GRCz11 9 38961368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCCAACTTTACCAGATAATGAGAAAGAGTTGCCTGACAAACCAGCT[G/T]AAATCTTTATCACACCAAAGGTGACGGTTACTCTTGAGGAAGCAAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059736   None 248 None 5
ENSDART00000077358   None 291 None 5
ENSDART00000112298 Essential Splice Site 1338 1710 9 16
ENSDART00000134294 Essential Splice Site 173 374 4 8
ENSDART00000135581   None 169 None 3
ENSDART00000135902   None 248 None 6
ENSDART00000140436 Essential Splice Site 300 591 4 9
ENSDART00000144893   None 154 None 4
ENSDART00000148306 Essential Splice Site 147 179 5 6
Genomic Location (Zv9):
Chromosome 9 (position 40019198)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39157094
GRCz11 9 38966889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGACTGCCTTTCAGTGTGGCCAGGCACTCAAGAGACCGAGCATCTG[T/A]AAGAACCATATCAGATTTACGTCTTATACAAGTATATTAAAGTAATAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link