
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:66475
- Ensembl ID:
- ENSDARG00000054999
- ZFIN ID:
- ZDB-GENE-040426-1644
- Description:
- hypothetical protein LOC394039 [Source:RefSeq peptide;Acc:NP_957358]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16528 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16528
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000077278 | Essential Splice Site | 457 | 516 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 2 (position 13772892)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 12578833 GRCz11 2 13939862 - KASP Assay ID:
- 2259-1728.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGAATGACCGTTTGTCTCTAGATGGCTGTGATCCCAACGGATATGTGG[G/T]TAAGAAACAGGATGTTTTGATTGCTCTAAAAGATTAAATATGTTCTTGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: