zgc:114103

Ensembl ID:
ENSDARG00000054930
ZFIN ID:
ZDB-GENE-050913-64
Description:
Transmembrane protein adipocyte-associated 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q4V8X0]
Human Orthologue:
TPRA1
Human Description:
transmembrane protein, adipocyte asscociated 1 [Source:HGNC Symbol;Acc:30413]
Mouse Orthologue:
Tpra1
Mouse Description:
transmembrane protein, adipocyte asscociated 1 Gene [Source:MGI Symbol;Acc:MGI:1345190]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9949 Essential Splice Site Available for shipment Available now
sa11107 Essential Splice Site Available for shipment Available now
sa9851 Essential Splice Site Available for shipment Available now
sa18832 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38533 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077209 Essential Splice Site None 378 1 11
Genomic Location (Zv9):
Chromosome 6 (position 1655877)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1600494
GRCz11 6 1553166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACACYAAAGCACTTCAGAATCTGAWCTGAGACYACCAGCGCTYAAAGG[T/C]GAGTGTGTTTTTGTGAGGTTGAGCAGCTGATTTATCCGTGCAGCGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077209 Essential Splice Site 99 378 3 11
Genomic Location (Zv9):
Chromosome 6 (position 1649816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1594433
GRCz11 6 1546687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGATCCGCTTGACCTCCAGCCCCATATTTGTGGCGTTTTACATATTG[G/T]TAAGCAGCCRATCCATCCTAAAGCATCCATATATTYTCAACACYGGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077209 Essential Splice Site 129 378 5 11
ENSDART00000077209 Essential Splice Site 129 378 5 11
Genomic Location (Zv9):
Chromosome 6 (position 1647089)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1591706
GRCz11 6 1543982
KASP Assay ID:
2259-6982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACACACACACACACAYGTTTGGTTCTGATATTGTCAGTGTGTTTGCA[G/T]GTGCTTTGGGAAATCACAAGGTTCTTTTTATTGGCTATTGAGCTCAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077209 Essential Splice Site 129 378 5 11
ENSDART00000077209 Essential Splice Site 129 378 5 11
Genomic Location (Zv9):
Chromosome 6 (position 1647089)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1591706
GRCz11 6 1543982
KASP Assay ID:
2259-6982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACACACACACACATGTTTGGTTCTGATATTGTCAGTGTGTTTGCA[G/T]GTGCTTTGGGAAATCACAAGGTTCTTTTTATTGGCTATTGAGCTCAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077209 Nonsense 244 378 9 11
Genomic Location (Zv9):
Chromosome 6 (position 1642275)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1586892
GRCz11 6 1539123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATGATGATCAATGTGTTTGTGCAGCGAAGAGGAGTTTTTACGTGTA[T/A]TCGGGGATCCTGGCGCTGCTGAATCTGGTTCAGGGTTTGGGAAGTGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link