zgc:92203

Ensembl ID:
ENSDARG00000054897
ZFIN ID:
ZDB-GENE-040718-385
Description:
prolactin regulatory element-binding protein [Source:RefSeq peptide;Acc:NP_001002638]
Human Orthologue:
PREB
Human Description:
prolactin regulatory element binding [Source:HGNC Symbol;Acc:9356]
Mouse Orthologue:
Preb
Mouse Description:
prolactin regulatory element binding Gene [Source:MGI Symbol;Acc:MGI:1355326]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16879 Nonsense Available for shipment Available now
sa2846 Nonsense Confirmed mutation in F2 line During 2018
sa42645 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077182 Nonsense 227 425 6 10
Genomic Location (Zv9):
Chromosome 16 (position 3178585)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2337324
GRCz11 16 2574990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTTTGTGAACGCAGCACATYGTGACGGTRGGCYGTGATTTCGAGTG[C/A]AGCGTGTGGAGCGGAGATCAGCTGGCTGTGGGGTWGTGTTGGCATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2846
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077182 Nonsense 239 425 6 10
Genomic Location (Zv9):
Chromosome 16 (position 3178620)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2337359
GRCz11 16 2575025
KASP Assay ID:
554-2705.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTGATTTCGAGTGCAGCGTGTGGAGCGGAGATCAGCTGGCTGTGGGGT[T/A]GTGTTGGCATGAAAATATGCCTCAGATCACAGAGAAGACGTACCGATACA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
whole organism
ZFA:0001094
hemorrhagic
PATO:0002105
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa42645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077182 Nonsense 276 425 7 10
Genomic Location (Zv9):
Chromosome 16 (position 3181087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2339814
GRCz11 16 2577480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGCAAAGGTAGAGGACCAAAAAGATGCTTTAAGGCTGTATACAGTC[C/T]AAATCCCCCACAAACGAGACCGCAAACCCCCTCCATGCTACATCACCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link